mouse jun qpcr primer pair Search Results


92
OriGene gtggtagtaaccaaagcatctgc
Gtggtagtaaccaaagcatctgc, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+jun+qpcr+primer+pair/Oprk1+Mouse+qPCR+Primer+Pair/pmc07385665-101-7-9
Average 92 stars, based on 1 article reviews
gtggtagtaaccaaagcatctgc - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
OriGene primer
Primer, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+jun+qpcr+primer+pair/Rcbtb2+Mouse+qPCR+Primer+Pair/pm25762510-58-36-39
Average 90 stars, based on 1 article reviews
primer - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene cxcl9
Figure 5. Absence of NLRC4 in macrophages alters the tumor cytokine and chemokine milieu. (A–F) WT and Nlrc4–/– mice were injected s.c. with 1 × 105 B16F10 cells. On day 12 after inoculation, total RNA was isolated from homogenized tumors and used to determine cytokine and chemokine expression via quantitative qPCR utilizing a PCR array. Selected genes from the array are displayed; data are pooled from 3 separate experiments (n = 3 mice per group). (G and H) WT and Nlrc4–/– mice were injected s.c. with 1 × 105 B16F10 cells; 14 days after inoculation, tumors were harvested, pooled, and FACS sorted based on CD45.2 and F4/80 staining. RNA was isolated from CD45.2- and CD45.2+F4/80+ cells and used to determine <t>Cxcl9,</t> Cxcl10, Cxcl13, and Cxcl16 expression by qPCR; data are representative of 2 independent experiments with n ≥ 5 pooled tumors per group. (I) WT and Nlrc4–/– BMDMs were challenged for 9 hours with B16F10 whole tumor homogenate. <t>Cxcl9,</t> Cxcl10, and Cxcl13 expression was determined by qPCR. Data are pooled from 3 independent experi- ments, and fold change in gene expression is relative to unstimulated samples. (J and K) WT and Nlrc4–/– BMDMs were challenged with 50 ng/ml LPS, 50 μg/ml LTA, 100 ng/ml FSL-1, and 1 μg/ml Pam3CSK4. Twenty hours later, supernatants were collected and levels of IL-6 (J) and IL-12p40 (K) determined by ELISA; data are representative of 3 independent experiments. (A–F and I) Error bars represent SEM. (J and K) Error bars represent SD. (I–K) *P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001, unpaired 2-tailed Student’s t test.
Cxcl9, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+jun+qpcr+primer+pair/Cxcl9+Mouse+qPCR+Primer+Pair/10__1172_slash_jci86953-272-1-11
Average 90 stars, based on 1 article reviews
cxcl9 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene mouse pfkfb3
Fig. 4 Impact of PSH-L at different doses of pshPFKFB3 on <t>PFKFB3</t> mRNA expression in A549 cells. Bar graph depicts real-time RT-PCR expression of PFKFB3 as compared to untreated control cells. The results show mean of three independent experiments with SEM. NC-pDNA-L liposomes with 100 ng of NC-pDNA, LF2K100 = Lipofectamine-2000 complexed with pshPFKFB3 100 ng, PSH-L20, 40, 60 and 100 = PSH-L with 20 ng, 40 ng, 60 ng and 100 ng of pshPFKFB3.
Mouse Pfkfb3, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+jun+qpcr+primer+pair/Pfkfb3+Mouse+qPCR+Primer+Pair/pm28875330-63-3-8
Average 90 stars, based on 1 article reviews
mouse pfkfb3 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

92
OriGene cggttagcagtatgttgtccagc 30 origene n a primers
Fig. 4 Impact of PSH-L at different doses of pshPFKFB3 on <t>PFKFB3</t> mRNA expression in A549 cells. Bar graph depicts real-time RT-PCR expression of PFKFB3 as compared to untreated control cells. The results show mean of three independent experiments with SEM. NC-pDNA-L liposomes with 100 ng of NC-pDNA, LF2K100 = Lipofectamine-2000 complexed with pshPFKFB3 100 ng, PSH-L20, 40, 60 and 100 = PSH-L with 20 ng, 40 ng, 60 ng and 100 ng of pshPFKFB3.
Cggttagcagtatgttgtccagc 30 Origene N A Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+jun+qpcr+primer+pair/Trim30a+Mouse+qPCR+Primer+Pair/pm39753138-244-13-14
Average 92 stars, based on 1 article reviews
cggttagcagtatgttgtccagc 30 origene n a primers - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

axl  (OriGene)
94
OriGene axl
Fig. 4 Impact of PSH-L at different doses of pshPFKFB3 on <t>PFKFB3</t> mRNA expression in A549 cells. Bar graph depicts real-time RT-PCR expression of PFKFB3 as compared to untreated control cells. The results show mean of three independent experiments with SEM. NC-pDNA-L liposomes with 100 ng of NC-pDNA, LF2K100 = Lipofectamine-2000 complexed with pshPFKFB3 100 ng, PSH-L20, 40, 60 and 100 = PSH-L with 20 ng, 40 ng, 60 ng and 100 ng of pshPFKFB3.
Axl, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+jun+qpcr+primer+pair/Axl+Mouse+qPCR+Primer+Pair/pmc13134324-359-38-39
Average 94 stars, based on 1 article reviews
axl - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
OriGene itgax
Fig. 4 Impact of PSH-L at different doses of pshPFKFB3 on <t>PFKFB3</t> mRNA expression in A549 cells. Bar graph depicts real-time RT-PCR expression of PFKFB3 as compared to untreated control cells. The results show mean of three independent experiments with SEM. NC-pDNA-L liposomes with 100 ng of NC-pDNA, LF2K100 = Lipofectamine-2000 complexed with pshPFKFB3 100 ng, PSH-L20, 40, 60 and 100 = PSH-L with 20 ng, 40 ng, 60 ng and 100 ng of pshPFKFB3.
Itgax, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+jun+qpcr+primer+pair/Itgax+Mouse+qPCR+Primer+Pair/pmc13134324-359-32-33
Average 94 stars, based on 1 article reviews
itgax - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

90
OriGene c1qc
Fig. 4 Impact of PSH-L at different doses of pshPFKFB3 on <t>PFKFB3</t> mRNA expression in A549 cells. Bar graph depicts real-time RT-PCR expression of PFKFB3 as compared to untreated control cells. The results show mean of three independent experiments with SEM. NC-pDNA-L liposomes with 100 ng of NC-pDNA, LF2K100 = Lipofectamine-2000 complexed with pshPFKFB3 100 ng, PSH-L20, 40, 60 and 100 = PSH-L with 20 ng, 40 ng, 60 ng and 100 ng of pshPFKFB3.
C1qc, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+jun+qpcr+primer+pair/C1qc+Mouse+qPCR+Primer+Pair/10__1161_slash_circulationaha__113__005991-262-12-24
Average 90 stars, based on 1 article reviews
c1qc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

94
OriGene mrorc r cctgcacattctgactaggacg

Mrorc R Cctgcacattctgactaggacg, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+jun+qpcr+primer+pair/Rorc+Mouse+qPCR+Primer+Pair/pmc11079465-50-0-4
Average 94 stars, based on 1 article reviews
mrorc r cctgcacattctgactaggacg - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

92
OriGene cxcr4 mouse qpcr primer pair
Female mice ( n = 4 per group) were given 200 μL PBS vehicle control, 10 ng D270N, or 10 ng TcdB2 in PBS by the s.c. route. Seven days post treatment, RNA was purified from axillary and inguinal lymph nodes (aLNs and iLNs). Gene expression was quantified using the Nanostring nCounter SPRINT profiler platform. (A) Differentially expressed genes (DEGs) comparing TcdB2 to PBS (left), TcdB2 to D270N (center), or D270N to PBS (right). (B) Summary of the log2 fold change, raw p values, and adjusted p values (Benjamin-Yekutieli method) for each two-way comparison in the experiment. Values for <t>cxcr4,</t> cxcr5, ccr7 , and their ligands are depicted. A full list of chemokines and their receptors is shown in . (C) Relative expression of cxcr4, cxcr5 , and ccr7 in isolated B cells as determined by qPCR. Graphs show the increase in expression relative to vehicle-treated control mice and are normalized to gapdh expression using the ΔΔC T method. Data show mean ± SD for 5 mice per group. (D and E) B cell (D) and CD4 + T cell (E) CXCR4 and CXCR5 expression was measured by flow cytometry. Flow plots show CXCR4 versus CXCR5 expression, while graphs depict the mean ± SD percentage of each cell type expressing high levels of CXCR4. Data in are pooled from 3 experiments ( n = 9 per group). Statistical significance was determined by one-way ANOVA with Kruskal-Wallace post-test (** p < 0.01, *** p < 0.001).
Cxcr4 Mouse Qpcr Primer Pair, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+jun+qpcr+primer+pair/Cxcr4+Mouse+qPCR+Primer+Pair/pmc11210377-55-0-6
Average 92 stars, based on 1 article reviews
cxcr4 mouse qpcr primer pair - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

92
OriGene gatcctctcttctgccattggtc
List of primers used in qRT-PCR assays.
Gatcctctcttctgccattggtc, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+jun+qpcr+primer+pair/Oprm1+Mouse+qPCR+Primer+Pair/pmc11535536-4-3-5
Average 92 stars, based on 1 article reviews
gatcctctcttctgccattggtc - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
OriGene mir 1281
List of primers used in qRT-PCR assays.
Mir 1281, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+jun+qpcr+primer+pair/Mir18b+Mouse+qPCR+Primer+Pair/pmc07754065-31-12-32
Average 90 stars, based on 1 article reviews
mir 1281 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Figure 5. Absence of NLRC4 in macrophages alters the tumor cytokine and chemokine milieu. (A–F) WT and Nlrc4–/– mice were injected s.c. with 1 × 105 B16F10 cells. On day 12 after inoculation, total RNA was isolated from homogenized tumors and used to determine cytokine and chemokine expression via quantitative qPCR utilizing a PCR array. Selected genes from the array are displayed; data are pooled from 3 separate experiments (n = 3 mice per group). (G and H) WT and Nlrc4–/– mice were injected s.c. with 1 × 105 B16F10 cells; 14 days after inoculation, tumors were harvested, pooled, and FACS sorted based on CD45.2 and F4/80 staining. RNA was isolated from CD45.2- and CD45.2+F4/80+ cells and used to determine Cxcl9, Cxcl10, Cxcl13, and Cxcl16 expression by qPCR; data are representative of 2 independent experiments with n ≥ 5 pooled tumors per group. (I) WT and Nlrc4–/– BMDMs were challenged for 9 hours with B16F10 whole tumor homogenate. Cxcl9, Cxcl10, and Cxcl13 expression was determined by qPCR. Data are pooled from 3 independent experi- ments, and fold change in gene expression is relative to unstimulated samples. (J and K) WT and Nlrc4–/– BMDMs were challenged with 50 ng/ml LPS, 50 μg/ml LTA, 100 ng/ml FSL-1, and 1 μg/ml Pam3CSK4. Twenty hours later, supernatants were collected and levels of IL-6 (J) and IL-12p40 (K) determined by ELISA; data are representative of 3 independent experiments. (A–F and I) Error bars represent SEM. (J and K) Error bars represent SD. (I–K) *P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001, unpaired 2-tailed Student’s t test.

Journal: Journal of Clinical Investigation

Article Title: NLRC4 suppresses melanoma tumor progression independently of inflammasome activation

doi: 10.1172/jci86953

Figure Lengend Snippet: Figure 5. Absence of NLRC4 in macrophages alters the tumor cytokine and chemokine milieu. (A–F) WT and Nlrc4–/– mice were injected s.c. with 1 × 105 B16F10 cells. On day 12 after inoculation, total RNA was isolated from homogenized tumors and used to determine cytokine and chemokine expression via quantitative qPCR utilizing a PCR array. Selected genes from the array are displayed; data are pooled from 3 separate experiments (n = 3 mice per group). (G and H) WT and Nlrc4–/– mice were injected s.c. with 1 × 105 B16F10 cells; 14 days after inoculation, tumors were harvested, pooled, and FACS sorted based on CD45.2 and F4/80 staining. RNA was isolated from CD45.2- and CD45.2+F4/80+ cells and used to determine Cxcl9, Cxcl10, Cxcl13, and Cxcl16 expression by qPCR; data are representative of 2 independent experiments with n ≥ 5 pooled tumors per group. (I) WT and Nlrc4–/– BMDMs were challenged for 9 hours with B16F10 whole tumor homogenate. Cxcl9, Cxcl10, and Cxcl13 expression was determined by qPCR. Data are pooled from 3 independent experi- ments, and fold change in gene expression is relative to unstimulated samples. (J and K) WT and Nlrc4–/– BMDMs were challenged with 50 ng/ml LPS, 50 μg/ml LTA, 100 ng/ml FSL-1, and 1 μg/ml Pam3CSK4. Twenty hours later, supernatants were collected and levels of IL-6 (J) and IL-12p40 (K) determined by ELISA; data are representative of 3 independent experiments. (A–F and I) Error bars represent SEM. (J and K) Error bars represent SD. (I–K) *P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001, unpaired 2-tailed Student’s t test.

Article Snippet: Ifng, Cxcl9, Cxcl10, Cxcl13, and Cxcl16 primer pairs were all from Origene.

Techniques: Injection, Isolation, Expressing, Staining, Gene Expression, Enzyme-linked Immunosorbent Assay

Fig. 4 Impact of PSH-L at different doses of pshPFKFB3 on PFKFB3 mRNA expression in A549 cells. Bar graph depicts real-time RT-PCR expression of PFKFB3 as compared to untreated control cells. The results show mean of three independent experiments with SEM. NC-pDNA-L liposomes with 100 ng of NC-pDNA, LF2K100 = Lipofectamine-2000 complexed with pshPFKFB3 100 ng, PSH-L20, 40, 60 and 100 = PSH-L with 20 ng, 40 ng, 60 ng and 100 ng of pshPFKFB3.

Journal: Pharmaceutical research

Article Title: Liposomes co-Loaded with 6-Phosphofructo-2-Kinase/Fructose-2, 6-Biphosphatase 3 (PFKFB3) shRNA Plasmid and Docetaxel for the Treatment of non-small Cell Lung Cancer.

doi: 10.1007/s11095-017-2244-x

Figure Lengend Snippet: Fig. 4 Impact of PSH-L at different doses of pshPFKFB3 on PFKFB3 mRNA expression in A549 cells. Bar graph depicts real-time RT-PCR expression of PFKFB3 as compared to untreated control cells. The results show mean of three independent experiments with SEM. NC-pDNA-L liposomes with 100 ng of NC-pDNA, LF2K100 = Lipofectamine-2000 complexed with pshPFKFB3 100 ng, PSH-L20, 40, 60 and 100 = PSH-L with 20 ng, 40 ng, 60 ng and 100 ng of pshPFKFB3.

Article Snippet: Q-PCR primers for mouse PFKFB3 were purchased from Origene (Rockville, MD).

Techniques: Expressing, Quantitative RT-PCR, Control, Liposomes

Fig. 8 A. Western blot densitometric analysis of PFKFB3, various cell survival markers, apoptotic markers and stress related markers. The results show mean of three independent experiments. * indicates p < 0.05 compared with untreated controls; ** indicates p < 0.01 compared to untreated controls.

Journal: Pharmaceutical research

Article Title: Liposomes co-Loaded with 6-Phosphofructo-2-Kinase/Fructose-2, 6-Biphosphatase 3 (PFKFB3) shRNA Plasmid and Docetaxel for the Treatment of non-small Cell Lung Cancer.

doi: 10.1007/s11095-017-2244-x

Figure Lengend Snippet: Fig. 8 A. Western blot densitometric analysis of PFKFB3, various cell survival markers, apoptotic markers and stress related markers. The results show mean of three independent experiments. * indicates p < 0.05 compared with untreated controls; ** indicates p < 0.01 compared to untreated controls.

Article Snippet: Q-PCR primers for mouse PFKFB3 were purchased from Origene (Rockville, MD).

Techniques: Western Blot

Journal: iScience

Article Title: The IL-6 signaling pathway contributes critically to the immunomodulatory mechanism of human decidua-derived mesenchymal stromal cells

doi: 10.1016/j.isci.2024.109783

Figure Lengend Snippet:

Article Snippet: mRorc R: CCTGCACATTCTGACTAGGACG , Origene , Cat#MP212434.

Techniques: Virus, shRNA, Plasmid Preparation, Recombinant, SYBR Green Assay, Enzyme-linked Immunosorbent Assay

Female mice ( n = 4 per group) were given 200 μL PBS vehicle control, 10 ng D270N, or 10 ng TcdB2 in PBS by the s.c. route. Seven days post treatment, RNA was purified from axillary and inguinal lymph nodes (aLNs and iLNs). Gene expression was quantified using the Nanostring nCounter SPRINT profiler platform. (A) Differentially expressed genes (DEGs) comparing TcdB2 to PBS (left), TcdB2 to D270N (center), or D270N to PBS (right). (B) Summary of the log2 fold change, raw p values, and adjusted p values (Benjamin-Yekutieli method) for each two-way comparison in the experiment. Values for cxcr4, cxcr5, ccr7 , and their ligands are depicted. A full list of chemokines and their receptors is shown in . (C) Relative expression of cxcr4, cxcr5 , and ccr7 in isolated B cells as determined by qPCR. Graphs show the increase in expression relative to vehicle-treated control mice and are normalized to gapdh expression using the ΔΔC T method. Data show mean ± SD for 5 mice per group. (D and E) B cell (D) and CD4 + T cell (E) CXCR4 and CXCR5 expression was measured by flow cytometry. Flow plots show CXCR4 versus CXCR5 expression, while graphs depict the mean ± SD percentage of each cell type expressing high levels of CXCR4. Data in are pooled from 3 experiments ( n = 9 per group). Statistical significance was determined by one-way ANOVA with Kruskal-Wallace post-test (** p < 0.01, *** p < 0.001).

Journal: Cell reports

Article Title: Clostridioides difficile toxin B subverts germinal center and antibody recall responses by stimulating a drug-treatable CXCR4-dependent mechanism

doi: 10.1016/j.celrep.2024.114245

Figure Lengend Snippet: Female mice ( n = 4 per group) were given 200 μL PBS vehicle control, 10 ng D270N, or 10 ng TcdB2 in PBS by the s.c. route. Seven days post treatment, RNA was purified from axillary and inguinal lymph nodes (aLNs and iLNs). Gene expression was quantified using the Nanostring nCounter SPRINT profiler platform. (A) Differentially expressed genes (DEGs) comparing TcdB2 to PBS (left), TcdB2 to D270N (center), or D270N to PBS (right). (B) Summary of the log2 fold change, raw p values, and adjusted p values (Benjamin-Yekutieli method) for each two-way comparison in the experiment. Values for cxcr4, cxcr5, ccr7 , and their ligands are depicted. A full list of chemokines and their receptors is shown in . (C) Relative expression of cxcr4, cxcr5 , and ccr7 in isolated B cells as determined by qPCR. Graphs show the increase in expression relative to vehicle-treated control mice and are normalized to gapdh expression using the ΔΔC T method. Data show mean ± SD for 5 mice per group. (D and E) B cell (D) and CD4 + T cell (E) CXCR4 and CXCR5 expression was measured by flow cytometry. Flow plots show CXCR4 versus CXCR5 expression, while graphs depict the mean ± SD percentage of each cell type expressing high levels of CXCR4. Data in are pooled from 3 experiments ( n = 9 per group). Statistical significance was determined by one-way ANOVA with Kruskal-Wallace post-test (** p < 0.01, *** p < 0.001).

Article Snippet: Cxcr4 Mouse qPCR Primer Pair , OriGene , Cat # MP202423.

Techniques: Control, Purification, Gene Expression, Comparison, Expressing, Isolation, Flow Cytometry

(A) Female B6 mice ( n = 4 per group) were given 1 ng TcdB2, 1 ng D270N, or PBS vehicle control by the s.c. route. After 48 h, splenocytes, B cells, or CD4 + T cells were isolated (B and CD4 + T cells by magnetic separation) and seeded into the top of a Transwell. The bottom of the Transwell contained serum-free medium with or without CXCR12. Cells were incubated for 6 h, and then migratory cells were fixed and stained with crystal violet and counted. (B) Quantification of migratory splenocytes averaged from 4 fields of view from each Transwell membrane (mean ± SD, n = 4 per group). Data are representative of two independent experiments. (C) Representative flow cytometry plots for isolated B cells and CD4 + T cells. Graphs depict quantification of migratory B cells and CD4 + T cells (mean ± SD, n = 4 per group). Data are representative of two independent experiments. (D) Isolated B cells from vehicle-, D270N-, and TcdB2-treated mice were stimulated in vitro with ligands for CXCR4, CXCR5, and CCR7 (CXCL12, CCL19/CCL21, and CXCL13, respectively). Data are pooled from two independent experiments (mean ± SD, n = 8 per group). (E) Isolated splenic B cells were cultured with vehicle, D270N, or TcdB2 for 6 h ( n = 3). Graph shows mean ± SD, and data are representative of 2 similar experiments. Statistical significance was determined by one-way ANOVA: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

Journal: Cell reports

Article Title: Clostridioides difficile toxin B subverts germinal center and antibody recall responses by stimulating a drug-treatable CXCR4-dependent mechanism

doi: 10.1016/j.celrep.2024.114245

Figure Lengend Snippet: (A) Female B6 mice ( n = 4 per group) were given 1 ng TcdB2, 1 ng D270N, or PBS vehicle control by the s.c. route. After 48 h, splenocytes, B cells, or CD4 + T cells were isolated (B and CD4 + T cells by magnetic separation) and seeded into the top of a Transwell. The bottom of the Transwell contained serum-free medium with or without CXCR12. Cells were incubated for 6 h, and then migratory cells were fixed and stained with crystal violet and counted. (B) Quantification of migratory splenocytes averaged from 4 fields of view from each Transwell membrane (mean ± SD, n = 4 per group). Data are representative of two independent experiments. (C) Representative flow cytometry plots for isolated B cells and CD4 + T cells. Graphs depict quantification of migratory B cells and CD4 + T cells (mean ± SD, n = 4 per group). Data are representative of two independent experiments. (D) Isolated B cells from vehicle-, D270N-, and TcdB2-treated mice were stimulated in vitro with ligands for CXCR4, CXCR5, and CCR7 (CXCL12, CCL19/CCL21, and CXCL13, respectively). Data are pooled from two independent experiments (mean ± SD, n = 8 per group). (E) Isolated splenic B cells were cultured with vehicle, D270N, or TcdB2 for 6 h ( n = 3). Graph shows mean ± SD, and data are representative of 2 similar experiments. Statistical significance was determined by one-way ANOVA: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

Article Snippet: Cxcr4 Mouse qPCR Primer Pair , OriGene , Cat # MP202423.

Techniques: Control, Isolation, Incubation, Staining, Membrane, Flow Cytometry, In Vitro, Cell Culture

(A) Female B6 mice ( n = 5 infected, n = 4 control) were given cefoperazone for 10 days, then distilled drinking water for 2 days. Mice were then given heat-treated C. difficile R20291 spores or distilled water via oral gavage and lymphatic organs, colon, and cecum, and fecal samples were collected 2 days post gavage. (B) Mean ± SD weights (relative to the starting weight obtained 2 days before gavage). (C) Mean ± SD C. difficile CFUs from fecal samples collected 2 days post gavage. (D) Representative image of cecum and colon from a control mouse (left) and infected mouse (right). (E) Representative flow cytometry plot of the CXCR4 versus CXCR5 gating strategy (left, control; right, infected). (F–I) Mean ± SD percentage of CXCR4 hi B cells in (F) mLNs, (G) iLNs, (H) spleen, and (I) aLNs, determined by flow cytometry. (J) Mean ± SD numbers of migratory lymphocytes from mLNs averaged from 4 fields of view from each Transwell membrane. Statistical significance was determined by one-way ANOVA with Tukey’s multiple-comparisons post-test or two-tailed t test; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

Journal: Cell reports

Article Title: Clostridioides difficile toxin B subverts germinal center and antibody recall responses by stimulating a drug-treatable CXCR4-dependent mechanism

doi: 10.1016/j.celrep.2024.114245

Figure Lengend Snippet: (A) Female B6 mice ( n = 5 infected, n = 4 control) were given cefoperazone for 10 days, then distilled drinking water for 2 days. Mice were then given heat-treated C. difficile R20291 spores or distilled water via oral gavage and lymphatic organs, colon, and cecum, and fecal samples were collected 2 days post gavage. (B) Mean ± SD weights (relative to the starting weight obtained 2 days before gavage). (C) Mean ± SD C. difficile CFUs from fecal samples collected 2 days post gavage. (D) Representative image of cecum and colon from a control mouse (left) and infected mouse (right). (E) Representative flow cytometry plot of the CXCR4 versus CXCR5 gating strategy (left, control; right, infected). (F–I) Mean ± SD percentage of CXCR4 hi B cells in (F) mLNs, (G) iLNs, (H) spleen, and (I) aLNs, determined by flow cytometry. (J) Mean ± SD numbers of migratory lymphocytes from mLNs averaged from 4 fields of view from each Transwell membrane. Statistical significance was determined by one-way ANOVA with Tukey’s multiple-comparisons post-test or two-tailed t test; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

Article Snippet: Cxcr4 Mouse qPCR Primer Pair , OriGene , Cat # MP202423.

Techniques: Infection, Control, Flow Cytometry, Membrane, Two Tailed Test

Journal: Cell reports

Article Title: Clostridioides difficile toxin B subverts germinal center and antibody recall responses by stimulating a drug-treatable CXCR4-dependent mechanism

doi: 10.1016/j.celrep.2024.114245

Figure Lengend Snippet:

Article Snippet: Cxcr4 Mouse qPCR Primer Pair , OriGene , Cat # MP202423.

Techniques: Control, Virus, Recombinant, Expressing, Suspension, Protease Inhibitor, SYBR Green Assay, Cell Isolation, Binding Assay, Bradford Protein Assay, Cell Counting, Enzyme-linked Immunosorbent Assay, Gene Expression, Software, Simple Western, Protein Extraction

List of primers used in qRT-PCR assays.

Journal: Scientific Reports

Article Title: Nerve injury inhibits Oprd1 and Cnr1 transcription through REST in primary sensory neurons

doi: 10.1038/s41598-024-74487-1

Figure Lengend Snippet: List of primers used in qRT-PCR assays.

Article Snippet: Oprm1 Forward , GATCCTCTCTTCTGCCATTGGTC , OriGene Technologies, Inc, MP210417.

Techniques: